Ім'я файлу: МОЛЕКУЛЯРНО-ГЕНЕТИЧНІ МЕТОДИ В ДІАГНОСТИЦІ ГОСТРИХ ЛЕЙКЕМІЙ.docx
Розширення: docx
Розмір: 245кб.
Дата: 25.11.2021
Пов'язані файли:
Використання web.docx
Етіологія.Патогенез..docx
англ 4.docx
Control.pdf

МОЛЕКУЛЯРНО-ГЕНЕТИЧНІ МЕТОДИ В ДІАГНОСТИЦІ ГОСТРИХ ЛЕЙКЕМІЙ

Гострі лейкемії - біологічно гетерогенна група захворювань кровотворної системи в основі розвитку яких лежить неконтрольована проліферація стовбурових кровотворних клітин чи клітин-попередників.

Згідно останніх статистичних даних ВООЗ та Національного канцер-реєстру України середньорічний показник захворюваності становить 3-5 на 100 000 населення [1,2]. Питома вага гострих лейкемій є особливо високою у дітей та молоді 17-28 років. Тому є вкрай необхідною є своєчасна діагностика і визначення біологічного підтипу лейкемії, оскільки це забезпечить правильну тактику лікування і прогнозування перебігу захворювання. У випадку гострої лейкемії це вкрай непросте завдання оскільки згідно останньої ревізії четвертої ревізії класифікації та діагностичних критеріїв ВООЗ розрізняють більше 20 підтипів даної групи захворювань. На сьогодні для діагностики залучають комплекс сучасних підходів та методів, передусім цитоморфологічних, цитохімічних, методів імунофенотипування антигенів патологічних клітин, цитогенентичних методів. Окрім того значно розширено використання молекулярно-генетичних маркерів в якості одного з діагностичних критеріїв.

На сьогодні випадки гострої лейкемії поділяють на гострі лейкемії мієлоїдного походження, гострі лімфобластні лейкемії, гострі лейкемії недиференційовані. Кожна з цих груп поділяється на ряд підтипів.

Гостра мієлоїдна лейкемія (ГМЛ) - захворювання, що характеризується злоякісною трансформацією мієлоїдних клітин-попередників. Питома вага хворих на ГМЛ у дорослих складає до 80% від усіх хворих на гостру лейкемію з піком захворюваності після 60 років. Серед дітей дай тип лейкемії спостерігається в 15-20% випадків від хворих на гостру лейкемію дітей. В диференціюванні даної групи лейкемій використовуються цитогенетичне та молекулярно-біологічне виявлення таких аномалій транслока-ції t(8;21 )(q22;q22) і, відповідно, на молекулярному рівні злитого гена runxl-runxltl, inv(16)(pl3.1q22) або t( 16; 16)(р 13.1 ;q22) - cbfb-myhll, ,t( 15; 17)(q22;q 12) - pml-rara, AML with t(9; 11)(p22;q23) - mllt3-mll, t(6;9)(p23;q34) - dek-nup214, inv(3)(q21q26.2) або t(3;3)(q21 ;q26.2) -rpnl-evil, t( 1 ;22)(pl3;ql3) - rbml5-mkll, мутації в генах npml та cebpa [1].

Гостра лімфобластна лейкемія - захворювання, що характеризується неконтрольованою проліферацією незрілих трансформованих лімфоїдних клітин. Розрізняють В-клітинні форми ГЛЛ які складають 80-85 % і, відповідно, Т-клітинні - 15-20 % від всіх випадків ГЛЛ. Для гострої лімфобластної лейкемії у дітей при своєчасній постановці діагнозу характерна висока частота одужання. Так загальна виживаність сягає 80-86%, а безрецидивна п'ятирічна - 76-83%. При диференціюванні В-клітинних гострих лімфобластних лейкемій із характерними генетичними аномаліями класифікація ВООЗ виділяє такі перебудови: транслокацію t(9;22)(q34;q 11.2) і, відповідно, на молекулярному рівні злитий ген bcr-abll, ,t(v;llq23) (основні типи -t(4;ll)(q21;q23)) та t(9;l I)(p22;q23)), t(12;21)(pl3;q22) - tel-amll, t(5; 14)(q31 ;q32) -іІЗ-igh, t( 1; 19)(q23;p 13.3) - tcf3-pbx 1 [ 1 ].

Раніше для аналізу генетичних змін які відбуваються у хворих зі злоякісними новоутвореннями використовували переважно каріотипування за допомогою методу диференційного забарвлення метафазних хромосом, який дозволяє виявляти хромосомні перебудови, делеції, інверсії тощо. Саме філадельфійска хромосома t(9;22) (q34;ql 1) стала першим цитогенетичним маркером злоякісних новоутворень людини. Даний метод і досі є важливим і обов'язковим при клінічних обстеженнях пацієнтів оскільки він дозволяє проаналізувати каріотип хворого і виявляти додаткові хромосомні порушення, що може мати значення при призначенні курсу лікування та контролю стану в період ремісії. Разом з тим він має значні обмеження, насамперед через достатньо низьку чутливість та необхідність, в більшості випадків, проведення пункції кісткового мозку. Ще одним цитогенетичним методом є метод FISH - флуоресцентної гібридизації на препараті. Разом з цим все більш широкого застосування у клінічній практиці набувають молекулярно-генетичні методи діагностики. Насамперед це стосується використання полімеразної ланцюгової реакції, яка завдяки використанню специфічних праймерів і термостабільної полімерази дозволяє виявляти специфічний фрагмент ДНК (або РНК при проведенні реакції зворотної транскрипції) в кількості, достатній для розділення і аналізу ампліфікатів в агарозному гелі. У даній роботі наводиться метод виявлення, злитих генів mll/af4 (і, відповідно, транслокації t(4; 11)(q21;q23)) та mll/af9 (t(9;l I)(p22;q23) у хворих на гостру лейкемію. Транслокацію t(4; 1I)(q21;q23) виявляють у 50-70% ГЛЛ немовлят, 5% ГЛЛ у дорослих (переважно CD 19+ CD 10- pro B-ALL (CD19+, CD10-, cd24-), а також у пацієнтів хворих на гостру мієлобластну лейкемію М4/М5 типів. На молекулярному рівні дана транслокація призводить до утворення злитого гену mll/af4 [3].

Транслокації t(9;l I)(p22;q23) виявляють переважно у клітинах крові пацієнтів хворих на ГМЛ, переважно типу М5 та М4. Вона виникає як de novo, так і внаслідок терапії препаратами проти топоізомерази II. Загалом частота даної перебудови складає 2-5 % випадків ГЛЛ (до 25% de novo М5а у дітей). На молекулярному рівні дана транслокація призводить до утворення злитого гену mll/af9 [4,5].

Матеріали і методи

У роботі використовували вісім зразків крові хворих (за інформованої згоди), що проходили лікування в гематологічних клініках м. Києва. РНК виділяли згідно [6]. Виявлення злитого гена bcr-abll (транслокація t(9;22)(q34;ql 1.2)) проводили як описано нами раніше [7-8]. Зворотну транскрипцію проводили у суміші об’ємом ЗО мкл, що містила буфер для зворотної транскриптази, 1 мМ dNTP, 0,1 мкг праймера Random Hexamer Primer, 300 од зворотної транскриптази RevertAid™ M-MuLV Reverse Transcriptase (Fermentas), 20 од РНАзіну та 1-3 мкг РНК. Реакцію проводили при 42 оС протягом 1 год і зупиняли прогріванням при 70 оС 10 хв, 2 мкл кДНК використовували для проведення ПЛР. Праймери підбирали за допомогою програми Generunner (freeware) із залученням послідовностей NM_001197104.1 (mil), NM_004529.2 (af9 або mllt3) та nm_001166693.1 (af4 або affl). Проводили гніздову полімеразну ланцюгову реакцію в об’ємі 20 мкл. Для першого етапу виявлення злитого гена mll/af4 використовували праймеры MLL-F

GAGCAGTGTTGTGAAGAACGTG та AF4-R AGGAACTGTCTGAGTCACTGGTG. Для другого етапу використовували праймсри MLL-F1 AAGAGTGAAGAAGGGAATGTC та AF4-R1 GTTTGTTCACTGTCACTGTCC. ПЛР проводили за таких умов:для першого етапу ПЛР: 93°С -2 хвилини, 1 цикл, далі ЗО циклів: 93,5°С - 40 с; 55°С - 40 с; 72 °С - 2хв; для другого етапу ПЛР: 93°С - 2 хвилини, 1 цикл, далі ЗО циклів: 93,5°С - 40 с; 55°С - 30 с; 72°С - 1,5 хв. Для першого етапу виявлення злитого гена mll/af9 (варіант розриву між 4 та 5 м екзоном гена af9) використовували праймери MLL-F та AF9-R5 GTATCAGTGGTGGTGCGCTAG. Для другого етапу використовували праймери MLL-F1 та AF9-R51 GTGCTCCTTCATTAATTTGTG. ПЛР: 93°С - 2 хвилини, 1 цикл, далі 30 циклів: 93,5°С - 40 с; 55°С - 40 с; 72°С - 2хв; для другого етапу ПЛР: 93°С - 2 хвилини, 1 цикл, далі 30 циклів: 93,5°С - 40 с; 55°С - 30 с; 72°С - 1,5 хв. Для першого етапу виявлення злитого гена mll/af9 (варіант розриву між 5-1 Оми екзонами гена af9) використовували праймери MLL-F та AF9-R10 TCCAGTTGTTATATCCTCAGGATG. Для другого етапу використовували праймери MLL-F1 та AF9-R101 TCTATAAGGTTCACGATCTGC. ПЛР: 93°С - 2 хвилини, 1 цикл, далі 30 циклів: 93,5°С - 40 с; 55°С - 40 с; 72°С - 2хв; для другого етапу ПЛР: 93°С - 2 хвилини, 1 цикл, далі 30 циклів: 93,5°С - 40 с; 54°С - 30 с; 72°С - 1,5 хв. Продукти ампліфікації аналізували в 2 % агарозному гелі.

Результати та обговорення

Як було зазначено вище, існує кілька підходів до виявлення генетичних змін у хворих на гостру лейкемію. До основних відносять метод диференційного забарвлення метафазних хромосом, флуоресцентної гібридизації на препараті (FISH) та методи виявлення злитих генів за допомогою ПЛР. Кожен з методів має як переваги так і недоліки. Так метод диференційного забарвлення дозволяє проводити аналіз каріотипу в цілому і виявляти додаткові хромосомні реорганізації, в тому числі і ті, які виникають внаслідок застосування лікарських засобів. Однак дана методика вимагає високої кваліфікації, значного часу на проведення аналізу і має відносно невисоку чутливість. Метод гібридизації із флюорес-центними зондами на препараті має значно більшу чутливість, але є дорогим і дозволяє виявляти лише конкретний тип перебудови. До переваг ПЛР відносять насамперед те, що для проведення більшості аналізів не потрібно проводити досить травматичну процедуру - пункцію кісткового мозку, а достатньо лише провести забір
крові у хворого, невисока вартість одного аналізу та незначний час на його проведення і отримання результату. Тому створення тест-систем для виявлення основних типів злитих генів і їхнє впровадження у практику роботи молекулярно-генетичних центрів України, що створюються останнім часом є важливим завданням. Запропонований нами метод виявлення злитих генів mll/af4 та mll/af9 є складовою частиною комплексної системи для диференційної діагностики лейкемій. В якості позитивного контролю використовували виявлення транскриптів нормального гомологу гена abl [7, 8] та гена jak2 [9]. За допомогою запропонованої системи проаналізували дванадцять зразків крові хворих на ГЛ. У п’яти зразках крові було виявлено злитий ген bcr/abl (варіант р190). При аналізі зразка крові хворого Ф (рис.) після першого етапу ПЛР було виявлено крім позитивних контролів (доріжки 1 та 7) ампліфікат в доріжці 4, що вказує на наявність транскрипту гена mll/af4 (і відповідно транслокації t(4; 11 )(q21 ;q23)).

Рис. Електрофореграма розділення ампліфікатів після першого (а) та другого (б) етапів ЗТ-ПЛР аналізу зразка РНК хворого Ф. а) 1 - позитивний контроль (виявлення транскриптів нормального гомологу гена abl [за 8]); 2 - виявлення рі 90 bcr/ahl [за 8]; 3 - виявлення р210 bcr/abl [за 7]; 4 - виявлення злитого гена тії/; 5 - виявлення злитого гена тП/;6 - виявлення злитого гена tnll/af9; 7 - позитивний контроль (виявлення транскриптів гена jak2 [за 9]); 8 - маркер розмірів ДНК GeneRuler™ 100 bp DNA Ladder Fcrmentas. 6) 1 - позитивний контроль (виявлення транскриптів нормального гомологу гена abl [за 8]); 2 - виявлення р190 bcr/abl [за 8]; 3 - виявлення р210 bcr/abl [за 7]; 4 - виявлення злитого гена mll/af4; 5 - виявлення злитого гена mll/af9;f> - виявлення злитого гена mll/af9; 7 - маркер розмірів ДНК GeneRuler™ 100 bp DNA Ladder Fermentas.
Оскільки рівні експресії злитих генів часто недостатні для їхнього виявлення впродовж одного етапу ПЛР, було проведено другий етап ПЛР. Як видно з рис.1 (б) крім підтвердження наявності транскрипту гена mll/af4 (доріжка 4) виявлено перебудову Ьсг/аЬІ (яка є наслідком транслокації t(9;22)(q34;q 11)) причому як варіант р!90 bcr/abl (el/аЗ варіант перебудови) (доріжка 2), так і р210 bcr/abl (е14/аЗ варіант перебудови). Раніше було описано лише одиничні випадки одночасного виявлення такої комбінації злитих генів у хворих на ГЛЛ.
Таким чином, запропонована методика виявлення злитих генів mll/af4 та mll/af9 може використовуватись для генетичної діагностики гострих лейкемій. Її використання у поєднанні з цитоморфологічними, цитохімічними методами та імунофенотипуванням є важливою складовою запропонованої нами комплексної системи первинної та диференційної діагностики гострих лейкемій різного генезу, а також контролю динаміки протікання захворювання та ефективність лікування.
Література

1. Swerdlow, S.H., Campo, E., Harris, et al. WHO Classification of Tumours of Haematopoietic and Lymphoid Tissues, Fourth Edition. - Lyon: 1ARC Press, 2008. - P. 12-18.

2. Федоренко З.П., Гайсенко A.B., Гулак Л.О.,та ін Рак в Україні, 2010 - 2011. Захворюваність, смертність, показники діяльності онкологічної служби / Бюлетень Національного канцер-реестру УКРАЇНИ Видання № 13 (під ред. Щепотіна 1.Б.). - Київ, 2012. - С. 91-95.

3. Bueno С, Montes R, Catalina Р, et al. Insights into the cellular origin and etiology of the infant pro-B acute lymphoblastic leukemia with MLL-AF4 rearrangement // Leukemia. - 2011. - Vol. 25. - P. 400-410.

4. Langer T, Metzler M, Reinhardt D. et al. Analysis of t(9; 11) chromosomal breakpoint sequences in childhood acute leukemia: almost identical MLL breakpoints in therapy-related AML after treatment without etoposides // Genes Chromosomes Cancer. - 2003. - Vol. 36. - P. 393-401.

5. Gulley ML, Shea TC, Fedoriw Y. Genetic tests to evaluate prognosis and predict therapeutic response in acute myeloid leukemia // J Mol Diagn. - 2010 - Vol. 12, N.I. - P. 3-16.

6. Chomczynski P., Sacchi N. Single-step method of RNA isolation by acid guanidinum thiocyanate-phenol-chloroform extraction // Analyt. Biochem. - 1987. - Vol. 162. - P. 156-159.

7. Малюта C.C., Телегеев Г.Д., Дибков M.B., Мірошниченко Д.О., Єльська Г.В. Розробка тест-системи для діагностики Ph-лекемій за допомогою полімеразної ланцюгової реакції // Наука та інновації - 2005- Т.1. -С.70-75.

8. Телегеєв Г.Д., Дибков М.В., Божко М.В. Демиденко Д.В., Малюта С.С., Третяк Н.М., Бондар М.В. Моніторинг хронічного мієлолейкозу за допомогою молекулярно-біологічних методів (методичні рекомендації) // Республіканський центр науково-медичної інформації. - Київ, 1997. - С. 10-15.

9. Дибков М.В., Гартовська І.Р., Малюта С.С., Телегеєв Г.Д. Виявлення мутації V617F гена jak2 у хворих на хронічні мієлопроліферативні неоплазми // Biopolymers and Cell. - 2010. - Vol. 26. - P. 214-217.
скачати

© Усі права захищені
написати до нас